This question asks to generate the reverse complement of a sequence using "gsub". Using "gsub" is quite dangerous in this question. A better solution is to use "match", despite this not being the point of the exercise:
sequence <- "ATTACGACGCGATTCCCGGTTAATCGAATTCCCA"
# Complement of each nucleotide
dna_code <- c("A","C","G","T")
complement_code <- c("T","G", "C","A")
# Complement of sequence
comp_seq <- complement_code[match(sequence, dna_code)]
# Reverse
rev_comp <- rev(rev_comp)
# paste together
rev_comp <- paste(rev_comp, collapse = "")
This question asks to generate the reverse complement of a sequence using "gsub". Using "gsub" is quite dangerous in this question. A better solution is to use "match", despite this not being the point of the exercise: