Unitigs missing details on the lane they are found in

[rgladstone]

I ran

unitig-caller --call --refs assembly_paths.txt --out ZA_unitigs_v3 --write-graph --threads 32

Version 1.3.0. Where assembly_paths.txt had 1944 assembly paths, and the output had 903111 unitigs

Two unitigs had no lane details:

CCACCTTCCTCCGGTTTGTCACCGGCAGTCAACTTAGAGTGCCCAACTTAATGATGGCAACTAAGCTTAAGGGTTGCGCTCGTTGCGGGACTTAACC |
TTGTTCATAGTTCCATTATAGCAAAAAAAGGGCTCTATAATATTTGTAGTG | 15841_5_29:1

and

TAAAGAAGTCTCCGAAATTCCGCACTGAGCATCTTCTCCGAAAAAGGCCGCTAATGTGGCCTTTTTCTTTACCTGTGGTTCTCCGCCAAAATCCCAGCAAATTGCATCACCAAAGCTAAAAGCTTTCAGGGTTGTCTAAAAAGCACAAGACATAAGAGGAAGTGCGGTATTTTATAATCAAGCCCCCAAGAATTTACCATAACATCCGTTGCCCGCACCGCCTGAGACGCGTTCAGCGCGTTCCTGACGAAACCATGACAAAAACCACAACAAACCACCCCGGAACCCGTCAGAAACGCGCCTGTTAAATTTTAACGGCATGCATGACTATGCACCAGAATGACGCCATGCTCTTTTCACGCAAAAATCATCACCAGACGGGGAAAATCACCAGTGACCAGACAGGAATCCGCCGCCCTCAATATGGCCAAATTTATCCGCGCACAGACACTTCTCCTCCTTGAGCGGCTCGAGCAGATGGATCTGGATGAGGCTGCCGGCTGCTGTGAGCACCTGCACGATCAGGCCGAAGCGCTTTACGCCATGCTGAACGCACAGATAGGCGAGGAAAATGCGTGAAAATCGGTGAACGGGTGCGCAATTCAGTGCGCGGCCGTGAGGCGATGGCGGGGTGTCGGGGCGCAGCCCTGACCAGGGTATTTGTGATGCCGGCGCGTGCGCGGTATTACAAATGCACATCCTGTCCCGGAACGGACACCGGGAAACAGCAAAAAAAACCGGGCGGCACGCCCGGAACTCAATCAAGTTAGATTAGATTACTCTCACTCGTCCATAACAGCATCATGGAACGACGACCACCGTCCGTGACGGCCGCCTCGTTTAAGTATGGACAGAAATACAGAAAATGCTCAGGACGAAATGTAATGAATGCGAACGGATTCAAGAAATTCGAGCATGACAGTCCTTACGGCCGGTTCGGTTTCAGACAAAATCTGCCGGTATGCATCCAGCATCATGGCTCCGGCATCCCCTCCGGCACGCCGTAGCCAGACCGAAACAACGGACACAAGCAGGTGTCGCTCATCATCACTAAGAGTCATCAGGGCTCCGGAAGAAAAACCAAAC |
GAGCACTTTTAATTTGGTGACTTGAGTTATGAGCCAGAATATTTGTTTGACTTGAACTT | 15841_2_75:1

I just wanted to understand why this might be, in case lane IDs are missing from some of the other unitigs seen in more than one isolate.

[samhorsfield96]

Hi, would you be able to send across the assembly_paths.txt file, please?

[rgladstone]

assembly_paths.txt
Sure thing, attached now.

[samhorsfield96]

Hi Rebecca, if you could, would you be able to check the following, please:

• Are these unitigs present in the .gfa file generated by unitig-caller?
• Are these unitigs present in any of the source genomes (forward or reverse strand)?

As bifrost can merge k-mers across contig breaks, there is the possibility these unitigs are not present in any source genome.

[rgladstone]

Yes they are in the .gfa file and not in the assemblies so that makes sense, thanks for clarifying.

[samhorsfield96]

Hi Rebecca, it seems the issue might be with Bifrost where some k-mers are not annotated with colours (pmelsted/bifrost#73). I would suggest trying with an earlier version of Bifrost (e.g. v1.2.1) and see if this gives the same error.

[rgladstone]

Sorry for the delay! I have tried a conda env with unitig-caller 1.3.0 and bifrost 1.2.1, and that gave the same results. I noticed there was a fix for #29 so I tried replacing the bifrost.py code within unitig-caller 1.3.0 (bifrost 1.3.1) with the updated code and I still get the same results.