This tutorial was made by Cliff Bueno de Mesquita based on the original
MiSeq dada2 tutorial created by Angela Oliverio and Hannah
Holland-Moritz. It is currently maintained by Cliff Bueno de Mesquita
Updated February 5th, 2026
This pipeline runs the dada2 workflow for Big Data (single-end) from RStudio on the microbe server. This is for sequencing data from the ONT MinION machine, not the Illumina MiSeq. For the MiSeq pipeline, see https://github.com/fiererlab/dada2_fiererlab. In this pipeline, we start with a fastq file from the MinION that has been basecalled with super accurate basecalling. There are 8 samples (1 NTC and 7 replicates). We sequenced the known Zymo Community standard that contains 8 bacterial species so we could make sure the output matched the known community composition. For more information, see https://www.zymoresearch.com/collections/zymobiomics-microbial-community-standards/products/zymobiomics-microbial-community-standard. DO NOT use DADA2 if you did not perform super accurate basecalling, as the error rate will be too high. We will first use cutadapt to trim outer adapters and reorient the reads so they are in the same direction. Then we will use dorado to demultiplex the reads into their separate samples using barcodes.
We suggest opening the dada2 tutorial online to understand more about each step. The original pipeline on which this tutorial is based can be found here: https://benjjneb.github.io/dada2/bigdata_paired.html
| NOTE: There is a slightly different pipeline for ITS and non-“Big data” workflows. The non-“Big data” pipeline, in particular, has very nice detailed explanations for each step and can be found here: https://benjjneb.github.io/dada2/tutorial.html |
-
Check to make sure you know what your target ‘AMPLICON’ length is. This can vary between primer sets, as well as WITHIN primer sets. For example, ITS (internal transcribed spacer) amplicons can vary from ~100 bps to 300 bps. For examples regarding commonly used primer sets (515f/806r, Fungal ITS2, 1391f/EukBr) see protocols on the Earth Microbiome Project website: https://earthmicrobiome.org/protocols-and-standards/
-
Check to make sure you know your complete PCR construct, including the Illumina adapters, any pad and linker sequences, and the primer sequences. This is crucial for reorienting, trimming, and demultiplexing the reads properly.
-
Check to make sure you know how long your reads should be (i.e., how long should the reads be coming off the sequencer?) This is not the same as fragment length, as many times, especially with longer fragments, the entire fragment is not being sequenced in one direction.
-
Make note of which sequencing platform was used, as this can impact both read quality and downstream analysis. This pipeline was developed for the Oxford Nanopore Technologies MinION machine.
-
Decide which database is best suited for your analysis needs. Note that DADA2 requires databases be in a custom format! If a custom database is required, further formatting will be needed to ensure that it can run correctly in dada2.
See the following link for details regarding database formatting: https://benjjneb.github.io/dada2/training.html#formatting-custom-databases
-
For additional tutorials and reporting issues, please see link below:
dada2 tutorial: https://benjjneb.github.io/dada2/tutorial.html
dada2 pipeline issues*: https://github.com/fiererlab/dada2_ONT/issues*Note by default, only ‘OPEN’ issues are shown. You can look at all issues by removing “is:open” in the search bar at the top.
If you are running it through Fierer Lab “microbe” server:
To use the microbe server, open a terminal window, and type and hit return:
ssh <your microbe user name>@microbe.colorado.edu Setting up your password:
When you log in for the first time, you will have to set a new password. First, log in using your temporary password. The command prompt will then ask you to write a new password. Type it in once and hit return, then type it in again to verify. When you set a new password, make sure that it is something secure (i.e. has at least letters and numbers in it). Note, nothing will show up on the screen when you enter passwords.
Important: DO NOT give out your password to anyone!
Once you have logged in, you can download a copy of the tutorial into your directory on the server. To retrieve the folder with this tutorial from github directly to the server, type the following into your terminal and hit return after each line.
wget https://github.com/fiererlab/dada2_ONT/archive/master.zip
unzip master.zipIf there are ever updates to the tutorial on github, you can update the contents of this folder by downloading the new version from the same link as above.
- Open a your web browser and start a new empty tab
- Type
microbe.colorado.edu:8787in the address bar - Use your server login credentials to log into rstudio server
If you are running it on your own computer (runs slower!):
- Download this tutorial from github. Go to the homepage, and click the green “Clone or download” button. Then click “Download ZIP”, to save it to your computer. Unzip the file to access the R-script.
- Download the tutorial data from here http://cme.colorado.edu/projects/bioinformatics-tutorials
- Install dorado, NanoPlot, cutadapt, chopper. This pipeline is only
guaranteed to work using the versions with which it was first
developed which are dorado 0.8.2, NanoPlot 1.44.0, chopper 0.8.0,
cutadapt 4.9.
- dorado can be downloaded from https://cdn.oxfordnanoportal.com/software/analysis/dorado-0.8.2-linux-x64.tar.gz
- NanoPlot can be installed with pip (pip install NanoPlot=1.44.0)
- chopper can be installed with conda (conda create -n chopper_env -c bioconda chopper=0.8.0)
- cutadapt can be installed with conda (conda create -n cutadapt_env -c bioconda cutadapt=4.9)
- Download the most recent dada2-formatted reference database of your choice. Link to download here: https://benjjneb.github.io/dada2/training.html
First open the .R or .Rmd script in Rstudio. The R script is located in the tutorial folder you downloaded in the first step. You can navigate to the proper folder in Rstudio by clicking on the files tab and navigating to the location where you downloaded the github folder. Then click dada2_ONT and dada2_tutorial_ONT.R or dada2_tutorial_ONT.Rmd to open the R script.
Now, install DADA2 & other necessary packages. If this is your first time on Rstudio server, when you install a package you might get a prompt asking if you want to create your own library. Answer ‘yes’ twice in the console to continue.
| WARNING: This installation may take a long time, so only run this code if these packages are not already installed! |
install.packages("BiocManager")
BiocManager::install("dada2")
BiocManager::install("ShortRead")
install.packages("dplyr")
install.packages("tidyr")
install.packages("Hmisc")
install.packages("ggplot2")
install.packages("plotly")
install.packages("rlang")
install.packages("R.utils")
install.packages("tibble")
install.packages("microseq")
install.packages("readxl")
install.packages("writexl")Load DADA2 and required packages
library(dada2); packageVersion("dada2") # the dada2 pipeline
## [1] '1.32.0'
library(ShortRead); packageVersion("ShortRead") # dada2 depends on this
## [1] '1.62.0'
library(dplyr); packageVersion("dplyr") # for manipulating data
## [1] '1.1.4'
library(tidyr); packageVersion("tidyr") # for creating the final graph at the end of the pipeline
## [1] '1.3.1'
library(Hmisc); packageVersion("Hmisc") # for creating the final graph at the end of the pipeline
## [1] '5.1.3'
library(ggplot2); packageVersion("ggplot2") # for creating the final graph at the end of the pipeline
## [1] '3.5.1'
library(plotly); packageVersion("plotly") # for interactive graphs, helpful for quality plots
## [1] '4.10.4'
library(rlang); packageVersion("rlang") # for set_names() function
## [1] '1.1.4'
library(R.utils); packageVersion("R.utils") # for gzip
## [1] '2.12.3'
library(tibble); packageVersion("tibble") # for row names
## [1] '3.2.1'
library(microseq); packageVersion("microseq") # for writing fasta files
## [1] '2.1.6'
library(readxl); packageVersion("readxl") # for reading .xlsx files
## [1] '1.4.3'
library(writexl); packageVersion("writexl") # for writing .xlsx files
## [1] '1.5.1'Once the packages are installed, you can check to make sure the auxiliary software is working and set up some of the variables that you will need along the way.
| NOTE: If you are not working from microbe server, you will need to change the file paths for dorado, NanoPlot, chopper, and cutadapt to where they are stored on your computer/server. |
For this tutorial we will be working with 16S amplicons from the Zymo community standard, sequenced on an ONT MinION. We use the same library prep as the EMP 16S protocol typically used for MiSeq sequencing. The data are not paired so we will process them as if it’s a single end forward read. The data for these samples is on the microbe server (see the data.fp below).
# Set up pathway to python. We'll use this to run a script to check for the position of adapters and primers
# If you don't know the path, in the terminal run "which python"
python <- "/data/cliffb/miniforge3/bin/python"
system2(python, args = "--version")
# Set up pathway to dorado (demultiplexing tool) and test
# If you don't know the path, in the terminal run "which dorado"
# For Fierer Lab members this is in /data/shared
dorado <- "/data/shared/dorado-0.8.2-linux-x64/bin/dorado" # CHANGE ME to your path
system2(dorado, args = "--version") # Check by running shell command from R
# Set up pathway to NanoPlot (QC tool) and test
# If you don't know the path, in the terminal run "which NanoPlot"
NanoPlot <- "/data/cliffb/miniforge3/bin/NanoPlot" # CHANGE ME to your path
system2(NanoPlot, args = "--version") # Check by running shell command from R
# Set up pathway to chopper (read length and quality filter tool) and test
# If you don't know the path, in the terminal run "conda activate chopper_env" then "which chopper"
chopper <- "/data/cliffb/miniforge3/envs/chopper_env/bin/chopper" # CHANGE ME to your path
system2(chopper, args = "--version")
# Set up pathway to cutadapt (read reorientation and adapter/primer trimming tool) and test
# If you don't know the path, in the terminal run "conda activate cutadapt_env" then "which cutadapt"
# This pipeline was developed with cutadapt 4.9
cutadapt <- "/data/cliffb/miniforge3/envs/cutadapt_env/bin/cutadapt" # CHANGE ME to your path
system2(cutadapt, args = "--version") # Check by running shell command from R
# Set path to the input data, in this case a fastq.gz of super accurate basecalls
# Note: You MUST use "Super Accurate" (SUP) basecalling data (i.e., not "Fast" or "High Accuracy" modes)
# Note: If you have a folder (e.g. "fastq_pass") with many fastq files from the MinION, first concatenate them into a single file
# E.g.: cat fastq_pass/*.fastq.gz > sup_calls.fastq.gz
data.fp <- "/data/shared/Nanopore/Zymo_positive_control_10_28_2024/no_sample_id/20241028_1235_MN47817_FAZ82726_9877d59a/sup_calls.fastq.gz"Set up file paths in YOUR directory where you want data; you do not need to create the subdirectories but they are nice to have for organizational purposes.
project.fp <- "/data/cliffb/ONT_tutorial" # CHANGE ME to project directory; don't append with a "/"
if (!dir.exists(project.fp)) dir.create(project.fp)
# Set up names of sub directories to stay organized
Qstart.fp <- file.path(project.fp, "Qstart") # NanoPlot files, start
Qchopper.fp <- file.path(project.fp, "Qchopper") # NanoPlot files, chopper
QfiltN.fp <- file.path(project.fp, "QfiltN") # NanoPlot files, filtN
Qcut.fp <- file.path(project.fp, "Qcut") # NanoPlot files, cutadapt primer trim
Qfiltered.fp <- file.path(project.fp, "Qfiltered") # NanoPlot files, final filter and trim
preprocess.fp <- file.path(project.fp, "01_preprocess")
reorient.fp <- file.path(preprocess.fp, "reorient")
demux.fp <- file.path(preprocess.fp, "demux")
chopper.fp <- file.path(preprocess.fp, "chopper")
filtN.fp <- file.path(preprocess.fp, "filtN")
trimmed.fp <- file.path(preprocess.fp, "trimmed")
trimmed2.fp <- file.path(preprocess.fp, "trimmed2")
trimmed3.fp <- file.path(preprocess.fp, "trimmed3") # Might have to run cutadapt 3x to get everything
filter.fp <- file.path(project.fp, "02_filter")
table.fp <- file.path(project.fp, "03_tabletax") Pre-processing data for dada2 - reorient reads and trim outer adapters with cutadapt, demultiplex with dorado, filter by read length and minimum Q score with chopper, remove sequences with Ns with DADA2, trim primers with cutadapt
# Before we even begin, let's check the quality and read length distributions of our starting data
# This will included all of the adapters and primers in addition to our targeted sequence
# If it is taking a long time to run, you can increase the number of cores (-t argument)
# By default we are using 16 cores, but you can adjust the "16" as you want and based on server load
args <- c("-t", "16", "--fastq", data.fp, "-o", Qstart.fp, "--no_static", "--plots", "dot")
system2(NanoPlot, args = args)
stats_start <- read.delim(paste0(Qstart.fp, "/NanoStats.txt"))
head(stats_start, n = 8)
## General.summary.
## 1 Mean read length: 492.6
## 2 Mean read quality: 14.9
## 3 Median read length: 421.0
## 4 Median read quality: 16.4
## 5 Number of reads: 2,066,815.0
## 6 Read length N50: 428.0
## 7 STDEV read length: 3,450.4
## 8 Total bases: 1,018,165,033.0
# You may also want to scp that directory to your computer to look at the output plots
# LengthvsQualityScatterPlot_dot.html gives a nice overview of the read lengths and quality score distributions
# We'll be making these at each step of preprocessing so you can check how it changes
# We check the NanoStats.txt output to see mean length, mean quality, total readsBefore starting it’s good to familiarize yourself with the reads and constructs. You can use this script to check for any sequence, such as adapters, primers, or barcodes. Thank you to Matt and Mobeen for making this. It will tell you if the sequence is there and at what position. You can search for multiple sequences at once; just put a space between each sequence to search for. Here I’ll demonstrate a search for the outer Illumina adapters. We’ll search for the i5, i7, RC i5, and RC i7 sequences. The text output is printed and also saved as results.txt. It also makes folder called “output” with histograms.
args <- c(paste0(project.fp, "/", "find_illumina_adapters.py"), # Path to script
"--fastq_file", data.fp, # Input fastq.gz file. Must be .fastq.gz!
"--query", "AATGATACGGCGACCACCGAGATCTACAC ATCTCGTATGCCGTCTTCTGCTTG GTGTAGATCTCGGTGGTCGCCGTATCATT CAAGCAGAAGACGGCATACGAGAT", # Query sequences
"--results", paste0(project.fp, "/", "results.txt"),
"--output_histograms", paste0(project.fp, "/", "output"))
system2(python, args = args)The reads coming off of the MinION are not all oriented the same way. We’ll first reorient the reads, and then demultiplex them. We can reorient the reads using cutadapt and our knowledge of the adapter constructs. Make sure you know your constructs! For 16S, 18S, and ITS, the information is on the Earth Microbiome Project site https://earthmicrobiome.org/protocols-and-standards/. In the Fierer Lab we follow the EMP exactly for 16S and 18S, but for ITS we use something else for the FWD construct, and EMP for the REV construct. For this tutorial run the 16S section, but if you are using ITS, run the ITS section below.
Note: All reads are retained with this particular command, but you can see from the verbose cutadapt program output how many reads actually had the adapter constructs. Keep that in mind I designed this rhyme to explain in due time - that probably only reads with the adapter constructs will be able to be demultiplexed.
# Get the input files
fnF <- data.fp
# Make the output directory and paths
if (!dir.exists(preprocess.fp)) dir.create(preprocess.fp)
if (!dir.exists(reorient.fp)) dir.create(reorient.fp)
fnF.reorient <- file.path(reorient.fp, basename(fnF))
# Use the construct information and cutadapt to reorient reads to the same direction and trim the outer adapters
# These are 16S Illumina constructs from the EMP website
# The first sequence is N for barcode, then forward primer pad + linker + primer
# The second sequence is the reverse complement of the reverse primer pad + linker + primer
# min_overlap is set to the exact number of bases in the construct
# Run cutadapt on the super accurate basecalling fastq file
# This is tricky because we need a single quote around this -g argument, so make separately
adapter <- paste0(
"'",
"NNNNNNNNNNNNTATGGTAATTGTGTGYCAGCMGCCGCGGTAA;min_overlap=43...ATTAGAWACCCBNGTAGTCCGGCTGGCTGACT;min_overlap=32",
"'"
)
R1.flags <- paste("-g",
adapter,
"-e", 0.2) # Allow 0.2 error rate
system2(cutadapt, args = c(R1.flags,
"--action=retain",
"--buffer-size=1000000000",
"--cores=16", # Use 16 cores for speed
"--revcomp",
"-o", fnF.reorient, # Output
fnF, # Input
">", paste0(project.fp, "/", "cutadapt_reorient.log"))) # Save printed output text to a log file
# Check cutadapt_reorient.log and see how many reads had adapters
# cutadapt_reorient.log will be in your working directory
# Go there in terminal and run less cutadapt_reorient.log
# At the top will be a summary of how many reads had adapters
# This number should be > 70%
# You should also see that about (not exactly, but about) half have been reverse complemented (reoriented)
# If not, run the find_illumina_adapters.py script to search for adapters, primers, barcodes etc. to check the constructs.# N.B.! DO NOT use EMP website ITS rev constructs
# EMP website FWD constructs
# "1, 5′ Illumina adapter"
# "2, "Forward primer linker"
# "3, Forward primer (ITS1f; Note: This is 38 bp upstream of ITS1 from White et al., 1990.)"
# AATGATACGGCGACCACCGAGATCTACAC GG CTTGGTCATTTAGAGGAAGTAA
# 2011 Fierer REV constructs
# "1, Reverse complement of 3' Illumina adapter"
# "2, Golay barcode"
# "3, Reverse primer pad"
# "4, Reverse primer linker"
# "5, Reverse primer"
# CAAGCAGAAGACGGCATACGAGAT NNNNNNNNNNNN AGTCAGTCAG AT GCTGCGTTCTTCATCGATGC
# Get the input files
fnF <- data.fp
# Make the output directory and paths
if (!dir.exists(preprocess.fp)) dir.create(preprocess.fp)
if (!dir.exists(reorient.fp)) dir.create(reorient.fp)
fnF.reorient <- file.path(reorient.fp, basename(fnF))
# Use the construct information and cutadapt to reorient reads to the same direction and trim the outer adapters
# For ITS we need everything in reverse orientation so the barcodes are in the beginning
# The first sequence is the barcode (N), reverse primer pad + linker + primer
# The second sequence is the reverse complement of the forward linker + primer
# "NNNNNNNNNNNNAGTCAGTCAGATGCTGCGTTCTTCATCGATGC;min_overlap=44...TTACTTCCTCTAAATGACCAAGCC;min_overlap=24",
# min_overlap is set to the exact number of bases in the construct
# Run cutadapt on the super accurate basecalling fastq file
# This is tricky because we need a single quote around this -g argument, so make separately
adapter <- paste0(
"'",
"NNNNNNNNNNNNAGTCAGTCAGATGCTGCGTTCTTCATCGATGC;min_overlap=44...TTACTTCCTCTAAATGACCAAGCC;min_overlap=24",
"'"
)
R1.flags <- paste("-g",
adapter,
"-e", 0.2) # Allow 0.2 error rate
system2(cutadapt, args = c(R1.flags,
"--action=retain",
"--buffer-size=1000000000",
"--cores=16", # Use 16 cores for speed
"--revcomp",
"-o", fnF.reorient, # Output
fnF, # Input
">", paste0(project.fp, "/", "cutadapt_reorient.log"))) # Save printed output text to a log file
# Check cutadapt_reorient.log and see how many reads had adapters
# cutadapt_reorient.log will be in your working directory
# Go there in terminal and run less cutadapt_reorient.log
# At the top will be a summary of how many reads had adapters
# This number should be > 70%
# You should also see that about (not exactly, but about) half have been reverse complemented (reoriented)
# If not, run the find_illumina_adapters.py script to search for adapters, primers, barcodes etc. to check the constructs.# N.B.! This is two step PCR - see the diagram that Matt made for more info.
# Get the input files
fnF <- data.fp
# Make the output directory and paths
if (!dir.exists(preprocess.fp)) dir.create(preprocess.fp)
if (!dir.exists(reorient.fp)) dir.create(reorient.fp)
fnF.reorient <- file.path(reorient.fp, basename(fnF))
# Use the construct information and cutadapt to reorient reads to the same direction and trim the outer adapters
# For trnL we need everything in reverse orientation so the barcodes are in the beginning
# The first sequence is the barcode (N) + RC of the i7 interior primer + rev overhang + REV primer
# The second sequence is the reverse complement of the forward overhang + i5 interior primer + FWD primer
# min_overlap is set to the exact number of bases in the construct
# Run cutadapt on the super accurate basecalling fastq file
# This is tricky because we need a single quote around this -g argument, so make separately
adapter <- paste0(
"'",
"NNNNNNNNNNNNGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCATTGAGTCTCTGCACCTATC;min_overlap=68...CGTAGCGTCTACCGATTTCGCTGTCTCTTATACACATCTGACGCTGCCGACGAGCGATCTA;min_overlap=61",
"'"
)
R1.flags <- paste("-g",
adapter,
"-e", 0.2) # Allow 0.2 error rate
system2(cutadapt, args = c(R1.flags,
"--action=retain",
"--buffer-size=1000000000",
"--cores=16", # Use 16 cores for speed
"--revcomp",
"-o", fnF.reorient, # Output
fnF, # Input
">", paste0(project.fp, "/", "cutadapt_reorient.log"))) # Save printed output text to a log file
# Check cutadapt_reorient.log and see how many reads had adapters
# cutadapt_reorient.log will be in your working directory
# Go there in terminal and run less cutadapt_reorient.log
# At the top will be a summary of how many reads had adapters
# This number should be > 70%
# You should also see that about (not exactly, but about) half have been reverse complemented (reoriented)
# If not, run the find_illumina_adapters.py script to search for adapters, primers, barcodes etc. to check the constructs.# Get the input files
fnF <- data.fp
# Make the output directory and paths
if (!dir.exists(preprocess.fp)) dir.create(preprocess.fp)
if (!dir.exists(reorient.fp)) dir.create(reorient.fp)
fnF.reorient <- file.path(reorient.fp, basename(fnF))
# Use the construct information and cutadapt to reorient reads to the same direction and trim the outer adapters
# For CO1, it's similar to ITS, since the barcodes on on the reverse primers
# The first sequence is the barcode (N), reverse primer pad + linker + primer
# The second sequence is the reverse complement of the forward pad + linker + primer
# "NNNNNNNNNNNNAGTCAGTCAGCCWACTAATCAATTWCCAAATCCTCC;min_overlap=48...CCAAAAATAAAATATAAWGTTCCAATATCTACGAGCACCGCA;min_overlap=42",
# min_overlap is set to the exact number of bases in the construct
# Run cutadapt on the super accurate basecalling fastq file
# This is tricky because we need a single quote around this -g argument, so make separately
adapter <- paste0(
"'",
"NNNNNNNNNNNNAGTCAGTCAGCCWACTAATCAATTWCCAAATCCTCC;min_overlap=48...CCAAAAATAAAATATAAWGTTCCAATATCTACGAGCACCGCA;min_overlap=42",
"'"
)
R1.flags <- paste("-g",
adapter,
"-e", 0.2) # Allow 0.2 error rate
system2(cutadapt, args = c(R1.flags,
"--action=retain",
"--buffer-size=1000000000",
"--cores=16", # Use 16 cores for speed
"--revcomp",
"-o", fnF.reorient, # Output
fnF, # Input
">", paste0(project.fp, "/", "cutadapt_reorient.log"))) # Save printed output text to a log file
# Check cutadapt_reorient.log and see how many reads had adapters
# cutadapt_reorient.log will be in your working directory
# Go there in terminal and run less cutadapt_reorient.log
# At the top will be a summary of how many reads had adapters
# This number should be > 70%
# You should also see that about (not exactly, but about) half have been reverse complemented (reoriented)
# If not, run the find_illumina_adapters.py script to search for adapters, primers, barcodes etc. to check the constructs.
Use dorado to match barcodes and make separate files for each sample. First we will need to take the list of barcodes and sample IDs and turn it into a fasta file. We will make a list of generic names BC001, BC002 etc. and write another mapping file for how those map to the original sample IDs. Then you’ll need to make or adjust the arrangement .toml file according to the settings you want and how many barcodes you have. Then, run dorado. We have included template 16S, ITS, trnL, and CO1 .toml files in the GitHub directory that you can adjust for your own projects. Note: For both 16S and ITS we use forward oriented barcodes. Even though for MiSeq we used to use RC ITS barcodes, we have actually reverse complemented those during the reorientation step, so for this step, use normal (not RC) barcodes. Your mapping file should have no column names and should have barcodes as column 1 and sampleIDs as column 2.
# N.B.! Your mapping file should have no column names and should have barcodes as column 1 and sampleIDs as column 2.
# Function for making the files
make_demux_files <- function(file) {
mf <- readxl::read_xlsx(file, sheet = 1, col_names = FALSE) %>%
rlang::set_names(c("Sequence", "sampleID")) %>%
dplyr::mutate(barcodeID = sprintf("BC%03d", seq_along(1:nrow(.))))
fa <- mf %>%
dplyr::select(barcodeID, Sequence) %>%
dplyr::rename(Header = barcodeID)
microseq::writeFasta(fa, paste0(project.fp, "/barcodes.fasta"))
writexl::write_xlsx(mf, paste0(project.fp, "/barcode_map.xlsx"), format_headers = F)
}
# Make barcodes.fasta and barcodes_map.xlsx
# You will use barcodes_map.xlsx later when you make your metadata file!
# mapping file path - Replace me with your barcode/sampleID mapping file path!
file <- "/data/shared/Nanopore/Zymo_positive_control_10_28_2024/11.01.2024_PositiveControl_MappingFile.xlsx"
make_demux_files(file = file)
# Make your .toml arrangements file, put it on microbe (probably project.fp), and save the file path
toml.fp <- paste0(project.fp, "/barcode_arrangement_16S.toml") # Change if using a different construct
# Save the barcodes.fasta file path
barcodes.fp <- paste0(project.fp, "/barcodes.fasta")
# Set flags and run dorado
dorado.flags <- paste("demux", # demux function
fnF.reorient, # Input
"--output-dir", demux.fp, # Output
"--threads", 16, # Number of threads. Increase for speed.
"--verbose", # Print progress
"--emit-fastq", # Output as fastq
"--no-trim", # Don't trim the barcodes. We'll do that later
"--barcode-arrangement", toml.fp, # Parameters
"--barcode-sequences", barcodes.fp) # Fasta with barcodes
system2(dorado, args = dorado.flags)### Clean up demux files
demux_files <- list.files(demux.fp)
# Delete the unclassified reads (should be the last file)
unlink(paste0(demux.fp, "/", demux_files[length(demux_files)]), recursive = TRUE)
# Trim and adjust the file names to match the barcode_map.xlsx names
demux_files <- list.files(demux.fp)
demux_rename <- substr(demux_files,
start = nchar(demux_files) - 15,
stop = nchar(demux_files))
demux_rename <- gsub(pattern = "barcode",
replacement = "BC",
x = demux_rename)
# Rename
file.rename(from = list.files(demux.fp, full.names = TRUE),
to = paste0(demux.fp, "/", demux_rename))
## [1] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
# Check
list.files(demux.fp)
## [1] "BC001.fastq" "BC002.fastq" "BC003.fastq" "BC004.fastq" "BC005.fastq"
## [6] "BC006.fastq" "BC007.fastq" "BC008.fastq"
# Gzip these to save space
system2("gzip", list.files(demux.fp, full.names = TRUE))
# Now save file objects for downstream steps.
fnFs <- sort(list.files(demux.fp, pattern=".fastq.gz", full.names = TRUE))MinION reads have some lower quality reads that we should filter immediately as they will make it hard for cutadapt to find primers. There also may be some reads that are way too short or way to long. You can base the read length range you use on the output from the NanoPlot read length distributions. You can adjust the minimum quality score based on how stringent you want to be versus how many reads you want to get through. However, we recommend a minimum of Q21 for 250 bp amplicons so that at least 10% of the reads are error free. You will have to be even more stringent the longer the reads are. See here for more information. benjjneb/dada2#759. Let’s implement this with chopper. Here we will use Q30, min 250 and max 400, but those can be changed depending on your data.
# Make directory
if (!dir.exists(chopper.fp)) dir.create(chopper.fp)
# Name the chopper'd files to put them in chopper/ subdirectory
fnFs.chopper <- file.path(preprocess.fp, "chopper", basename(fnFs))
fnFs.chopper <- gsub(".gz", "", fnFs.chopper) # Output is unzipped
for (i in seq_along(fnFs)) {
system2(chopper,
args = c("-i", fnFs[i], # Input
"-t", 16, # Threads. Increase for speed.
"-q", 30, # Minimum quality score
"--minlength", 250, # Minimum read length
"--maxlength", 400), # Maximum read length
stdout = fnFs.chopper[i]) # Output
}
# Now recompress the files with gzip
list.files(chopper.fp)
## [1] "BC001.fastq" "BC002.fastq" "BC003.fastq" "BC004.fastq" "BC005.fastq"
## [6] "BC006.fastq" "BC007.fastq" "BC008.fastq"
for (i in seq_along(fnFs)) {
gzip(filename = fnFs.chopper[i],
destname = paste0(fnFs.chopper[i], ".gz"))
}
list.files(chopper.fp)
## [1] "BC001.fastq.gz" "BC002.fastq.gz" "BC003.fastq.gz" "BC004.fastq.gz"
## [5] "BC005.fastq.gz" "BC006.fastq.gz" "BC007.fastq.gz" "BC008.fastq.gz"
# Remake names for next step
fnFs.chopper <- file.path(preprocess.fp, "chopper", basename(fnFs))
# Now check mean Q score
args <- c("-t", "16", "--fastq", paste0(chopper.fp, "/*.fastq.gz"), "-o", Qchopper.fp, "--no_static", "--plots", "dot")
system2(NanoPlot, args = args)
stats_chopper <- read.delim(paste0(Qchopper.fp, "/NanoStats.txt"))
head(stats_chopper, n = 8)
## General.summary.
## 1 Mean read length: 327.8
## 2 Mean read quality: 34.0
## 3 Median read length: 328.0
## 4 Median read quality: 34.8
## 5 Number of reads: 382,532.0
## 6 Read length N50: 328.0
## 7 STDEV read length: 0.9
## 8 Total bases: 125,403,590.0
# Check the total number of reads now. If you use a high minQ like Q30, a lot of reads will be filtered out
# In this example, using minQ = 30 filtered out about ~70% of reads.
# However, now we are basically operating with Illumina quality!Ambiguous bases will make it hard for cutadapt to find short primer sequences in the reads. To solve this problem, we will remove sequences with ambiguous bases (Ns). If you used stringent filtering in the previous step, there may not be any reads with Ns left, but we will run the maxN = 0 filter regardless to make sure.
# Make directory
if (!dir.exists(filtN.fp)) dir.create(filtN.fp)
# Name the N-filtered files to put them in filtN/ subdirectory
fnFs.filtN <- file.path(preprocess.fp, "filtN", basename(fnFs))
# Filter Ns from reads and put them into the filtN directory
filterAndTrim(fnFs.chopper, fnFs.filtN, maxN = 0, multithread = TRUE)
# CHANGE multithread to FALSE on Windows (here and elsewhere in the program)
# Now check mean Q score
args <- c("-t", "16", "--fastq", paste0(filtN.fp, "/*.fastq.gz"), "-o", QfiltN.fp, "--no_static", "--plots", "dot")
system2(NanoPlot, args = args)
stats_filtN <- read.delim(paste0(QfiltN.fp, "/NanoStats.txt"))
head(stats_filtN, n = 8)
## General.summary.
## 1 Mean read length: 327.8
## 2 Mean read quality: 34.0
## 3 Median read length: 328.0
## 4 Median read quality: 34.8
## 5 Number of reads: 382,532.0
## 6 Read length N50: 328.0
## 7 STDEV read length: 0.9
## 8 Total bases: 125,403,590.0
# Note: For this tutorial, there weren't any Ns after the chopper step.Note: The multithread = TRUE setting can sometimes generate an error (names not equal). If this occurs, try rerunning the function. The error normally does not occur the second time. |
Assign the primers you used to “FWD” and “REV” below. Note primers should be not be reverse complemented ahead of time. Our tutorial data uses 515f and 806br. Those are the primers below. Change if you sequenced with other primers. See the Earth Microbiome project for standard 16S, 18S, and ITS primer sequences.
For ITS data: CTTGGTCATTTAGAGGAAGTAA is the ITS forward primer
sequence (ITS1F) and GCTGCGTTCTTCATCGATGC is ITS reverse primer
sequence (ITS2)
For trnL data: CGAAATCGGTAGACGCTACG is the trnL forward primer
sequence (trnL c) and CCATTGAGTCTCTGCACCTATC is trnL reverse primer
sequence (trnL h)
For CO1 data: AGATATTGGAACWTTATATTTTATTTTTGG is the CO1 forward primer sequence (CO1F) and WACTAATCAATTWCCAAATCCTCC is CO1 reverse primer sequence (CO1R)
# Detach the microseq package. We don't need it anymore and it causes trouble.
detach("package:microseq", unload=TRUE)
# Set up the primer sequences to pass along to cutadapt
FWD <- "GTGYCAGCMGCCGCGGTAA" ## CHANGE ME # this is 515f
REV <- "GGACTACNVGGGTWTCTAAT" ## CHANGE ME # this is 806Br
# Write a function that creates a list of all orientations of the primers
allOrients <- function(primer) {
# Create all orientations of the input sequence
require(Biostrings)
dna <- DNAString(primer) # The Biostrings works w/ DNAString objects rather than character vectors
orients <- c(Forward = dna, Complement = complement(dna), Reverse = reverse(dna),
RevComp = reverseComplement(dna))
return(sapply(orients, toString)) # Convert back to character vector
}
# Save the primer orientations to pass to cutadapt
FWD.orients <- allOrients(FWD)
REV.orients <- allOrients(REV)
FWD.orients
## Forward Complement Reverse
## "GTGYCAGCMGCCGCGGTAA" "CACRGTCGKCGGCGCCATT" "AATGGCGCCGMCGACYGTG"
## RevComp
## "TTACCGCGGCKGCTGRCAC"
REV.orients
## Forward Complement Reverse
## "GGACTACNVGGGTWTCTAAT" "CCTGATGNBCCCAWAGATTA" "TAATCTWTGGGVNCATCAGG"
## RevComp
## "ATTAGAWACCCBNGTAGTCC"
# Write a function that counts how many time primers appear in a sequence
primerHits <- function(primer, fn) {
# Counts number of reads in which the primer is found
nhits <- vcountPattern(primer, sread(readFastq(fn)), fixed = FALSE)
return(sum(nhits > 0))
}Before running cutadapt, we will look at primer detection for the first couple samples, as a check. There may be some primers here; we will remove them below using cutadapt. Since there are only 8 samples in this tutorial we will check all 8. If you have a lot of samples, just check the first couple. If your first couple samples happen to be blanks, change the numbers to real samples.
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[1]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[1]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 56228 0 0 0
## REV.ForwardReads 0 0 0 55691
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[2]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[2]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 40014 0 0 0
## REV.ForwardReads 0 0 0 39897
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[3]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[3]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 51495 0 0 0
## REV.ForwardReads 0 0 0 51094
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[4]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[4]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 67973 0 0 0
## REV.ForwardReads 0 0 0 67381
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[5]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[5]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 54221 0 0 0
## REV.ForwardReads 0 0 0 54213
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[6]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[6]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 53915 0 0 0
## REV.ForwardReads 0 0 0 53925
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[7]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[7]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 48035 0 0 0
## REV.ForwardReads 0 0 0 47854
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.filtN[[8]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.filtN[[8]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 66 0 0 0
## REV.ForwardReads 0 0 0 65Note: The flags are slightly different for 16S and ITS/trnL.
# Create directory to hold the output from cutadapt
if (!dir.exists(trimmed.fp)) dir.create(trimmed.fp)
fnFs.cut <- file.path(trimmed.fp, basename(fnFs.filtN))
# Save the reverse complements of the primers to variables
FWD.RC <- dada2:::rc(FWD)
REV.RC <- dada2:::rc(REV)
# 16S cutadapt flags
R1.flags <- paste("-g", FWD, "-a", REV.RC, "--minimum-length 50") # Note the min length 50 won't do anything if you already filtered out short reads with chopper
# ITS, trnL, CO1 cutadapt flags (since reads are flipped)
#R1.flags <- paste("-g", REV, "-a", FWD.RC, "--minimum-length 50") # Note the min length 50 won't do anything if you already filtered out short reads with chopper
# Run cutadapt with 16 cores
for (i in seq_along(fnFs)) {
system2(cutadapt, args = c(R1.flags,
"--cores=16",
"-o", fnFs.cut[i], # output files
fnFs.filtN[i])) # input files
}
# As a sanity check, we will check for primers in the first couple cutadapt-ed samples:
# They should all be zero!
# For ONT it looks like the first pass only cuts the RevComp off the REV.Forward reads, so we'll rerun
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[1]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[1]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 54276 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[2]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[2]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 38735 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[3]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[3]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 49843 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[4]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[4]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 65711 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[5]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[5]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 52572 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[6]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[6]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 52201 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[7]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[7]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 46482 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut[[8]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut[[8]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 62 0 0 0
## REV.ForwardReads 0 0 0 0# Run cutadapt a second time
if (!dir.exists(trimmed2.fp)) dir.create(trimmed2.fp)
fnFs.cut2 <- file.path(trimmed2.fp, basename(fnFs.filtN))
for (i in seq_along(fnFs)) {
system2(cutadapt, args = c(R1.flags,
"--cores=16",
"-o", fnFs.cut2[i], # output files
fnFs.cut[i])) # input files
}
# As a sanity check, we will check for primers in the first couple cutadapt-ed samples:
# They should all be zero!
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut2[[1]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut2[[1]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut2[[2]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut2[[2]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 1 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut2[[3]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut2[[3]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut2[[4]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut2[[4]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 2 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut2[[5]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut2[[5]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 3 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut2[[6]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut2[[6]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 1 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut2[[7]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut2[[7]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 4 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut2[[8]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut2[[8]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
# If you check each sample, some are all zero, while some have 1, 2, 3, or 4
# This is not much but lets rerun another time to get the stragglers# Run cutadapt a third time
if (!dir.exists(trimmed3.fp)) dir.create(trimmed3.fp)
fnFs.cut3 <- file.path(trimmed3.fp, basename(fnFs.filtN))
for (i in seq_along(fnFs)) {
system2(cutadapt, args = c(R1.flags,
"--cores=16",
"-o", fnFs.cut3[i], # output files
fnFs.cut2[i])) # input files
}
# As a sanity check, we will check for primers in the cutadapt-ed samples:
# They should all be zero!
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut3[[1]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut3[[1]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut3[[2]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut3[[2]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut3[[3]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut3[[3]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut3[[4]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut3[[4]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut3[[5]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut3[[5]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut3[[6]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut3[[6]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut3[[7]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut3[[7]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs.cut3[[8]]),
REV.ForwardReads = sapply(REV.orients, primerHits, fn = fnFs.cut3[[8]]))
## Forward Complement Reverse RevComp
## FWD.ForwardReads 0 0 0 0
## REV.ForwardReads 0 0 0 0
# We are all at zero now
# To save space, let's go ahead and delete trimmed.fp and trimmed2.fp
unlink(trimmed.fp, recursive = TRUE)
unlink(trimmed2.fp, recursive = TRUE)
# Now check mean Q score
args <- c("-t", "16", "--fastq", paste0(trimmed3.fp, "/*.fastq.gz"), "-o", Qcut.fp, "--no_static", "--plots", "dot")
system2(NanoPlot, args = args)
stats_cut <- read.delim(paste0(Qcut.fp, "/NanoStats.txt"))
head(stats_cut, n = 8)
## General.summary.
## 1 Mean read length: 253.2
## 2 Mean read quality: 34.4
## 3 Median read length: 253.0
## 4 Median read quality: 35.9
## 5 Number of reads: 382,532.0
## 6 Read length N50: 253.0
## 7 STDEV read length: 3.4
## 8 Total bases: 96,875,988.0# Put filtered reads into a new sub-directory for big data workflow
# Not really necessary here, but works
# We will keep the organization like the MiSeq pipeline for now
dir.create(filter.fp)
subF.fp <- file.path(filter.fp, "preprocessed_F")
dir.create(subF.fp)
# First see what samples had sequences. Some might have dropped!
list.files(trimmed3.fp)
## [1] "BC001.fastq.gz" "BC002.fastq.gz" "BC003.fastq.gz" "BC004.fastq.gz"
## [5] "BC005.fastq.gz" "BC006.fastq.gz" "BC007.fastq.gz" "BC008.fastq.gz"
length(list.files(trimmed3.fp)) # Is this the same number you started with?
## [1] 8
# If not, remake the fnFs.cut3 object with the samples that still have reads
# rm(fnFs.cut3)
# fnFs.cut3 <- vector()
# for (i in 1:length(list.files(trimmed3.fp))) {
# fnFs.cut3[i] <- paste0(trimmed3.fp, "/", list.files(trimmed3.fp)[i])
# }
# Move R1 from trimmed to separate new sub-directory
fnFs.Q <- file.path(subF.fp, basename(fnFs.cut3))
file.rename(from = fnFs.cut3, to = fnFs.Q)
## [1] TRUE TRUE TRUE TRUE TRUE TRUE TRUE TRUE
# File parsing; create file names
filtpathF <- file.path(subF.fp, "filtered") # files go into preprocessed_F/filtered/
fastqFs <- sort(list.files(subF.fp, pattern="fastq.gz"))Before choosing sequence variants, we want to trim reads where their
quality scores begin to drop (the truncLen and truncQ values) and
remove any low-quality reads that are left over after we have finished
trimming (the maxEE value). In the case of the ONT MinION, quality
scores do not drop off at the ends like they do with the MiSeq.
Therefore we will not set truncLen or truncQ. We will just filter based
on the desired read length and maximum error rate.
From dada2 tutorial: >If there is only one part of any amplicon bioinformatics workflow on which you spend time considering the parameters, it should be filtering! The parameters … are not set in stone, and should be changed if they don’t work for your data. If too few reads are passing the filter, increase maxEE and/or reduce truncQ. If quality drops sharply at the end of your reads, reduce truncLen. If your reads are high quality and you want to reduce computation time in the sample inference step, reduce maxEE.
It’s important to get a feel for the quality of the data that we are using. To do this, we will plot the quality of some of the samples.
From the dada2 tutorial: >In gray-scale is a heat map of the frequency of each quality score at each base position. The median quality score at each position is shown by the green line, and the quartiles of the quality score distribution by the orange lines. The red line shows the scaled proportion of reads that extend to at least that position (this is more useful for other sequencing technologies, as Illumina reads are typically all the same lenghth, hence the flat red line).
# If the number of samples is 20 or less, plot them all, otherwise, just plot 20 randomly selected samples
if( length(fastqFs) <= 20) {
fwd_qual_plots <- plotQualityProfile(paste0(subF.fp, "/", fastqFs))
} else {
rand_samples <- sample(size = 20, 1:length(fastqFs)) # grab 20 random samples to plot
fwd_qual_plots <- plotQualityProfile(paste0(subF.fp, "/", fastqFs[rand_samples]))
}
fwd_qual_plots# Optional: To make these quality plots interactive, call the plots through plotly
ggplotly(fwd_qual_plots)# write plots to disk
saveRDS(fwd_qual_plots, paste0(filter.fp, "/fwd_qual_plots.rds"))
ggsave(plot = fwd_qual_plots, filename = paste0(filter.fp, "/fwd_qual_plots.png"),
width = 10, height = 10, dpi = "retina")| WARNING: THESE PARAMETERS ARE NOT OPTIMAL FOR ALL DATASETS. Make sure you determine the trim and filtering parameters for your data. Here we do not truncate reads because quality scores to not drop off at the ends like they do in Illumina. DADA2 can handle variations in read length. Here we set minLen and maxLen to encompass the acceptable range of read length variation based on our knowledge of the amplicon as well as the NanoPlot read length distribution after trimming all primers. Check the results of the “stats_cut” file as well as the read distributions in the Qcut directory. Here we also set maxEE = 2. This may or may not filter more reads depending on what minQ you already ran with chopper. |
filt_out <- filterAndTrim(fwd = file.path(subF.fp, fastqFs),
filt = file.path(filtpathF, fastqFs),
maxEE = 2,
maxLen = 257, # Enforced before trimming and truncation
minLen = 250, # Enforced after trimming and truncation
rm.phix = TRUE,
compress = TRUE,
verbose = TRUE,
multithread = TRUE)
# look at how many reads were kept
filt_out
## reads.in reads.out
## BC001.fastq.gz 57695 57088
## BC002.fastq.gz 41224 40790
## BC003.fastq.gz 52782 52281
## BC004.fastq.gz 69690 68950
## BC005.fastq.gz 55908 55301
## BC006.fastq.gz 55707 55111
## BC007.fastq.gz 49457 48896
## BC008.fastq.gz 69 68
# summary of samples in filt_out by percentage
filt_out %>%
data.frame() %>%
mutate(Samples = rownames(.),
percent_kept = 100*(reads.out/reads.in)) %>%
select(Samples, everything()) %>%
summarise(min_remaining = paste0(round(min(percent_kept), 2), "%"),
median_remaining = paste0(round(median(percent_kept), 2), "%"),
mean_remaining = paste0(round(mean(percent_kept), 2), "%"),
max_remaining = paste0(round(max(percent_kept), 2), "%"))
## min_remaining median_remaining mean_remaining max_remaining
## 1 98.55% 98.93% 98.89% 99.05%
# If very few reads made it through, go back and tweak your parameters.
# Now check mean Q score
args <- c("-t", "16", "--fastq", paste0(filtpathF, "/*.fastq.gz"), "-o", Qfiltered.fp, "--no_static", "--plots", "dot")
system2(NanoPlot, args = args)
stats_filtered <- read.delim(paste0(Qfiltered.fp, "/NanoStats.txt"))
head(stats_filtered, n = 8)
## General.summary.
## 1 Mean read length: 252.9
## 2 Mean read quality: 34.4
## 3 Median read length: 253.0
## 4 Median read quality: 35.9
## 5 Number of reads: 378,485.0
## 6 Read length N50: 253.0
## 7 STDEV read length: 0.4
## 8 Total bases: 95,737,061.0Plot the quality of the filtered fastq files.
# figure out which samples, if any, have been filtered out
if( length(fastqFs) <= 20) {
remaining_samplesF <- fastqFs[
which(fastqFs %in% list.files(filtpathF))] # keep only samples that haven't been filtered out
fwd_qual_plots_filt <- plotQualityProfile(paste0(filtpathF, "/", remaining_samplesF))
} else {
remaining_samplesF <- fastqFs[rand_samples][
which(fastqFs[rand_samples] %in% list.files(filtpathF))] # keep only samples that haven't been filtered out
fwd_qual_plots_filt <- plotQualityProfile(paste0(filtpathF, "/", remaining_samplesF))
}
fwd_qual_plots_filt# write plots to disk
saveRDS(fwd_qual_plots_filt, paste0(filter.fp, "/fwd_qual_plots_filt.rds"))
ggsave(plot = fwd_qual_plots_filt, filename = paste0(filter.fp, "/fwd_qual_plots_filt.png"),
width = 10, height = 10, dpi = "retina")In this part of the pipeline dada2 will learn to distinguish error from biological differences using a subset of our data as a training set. After it understands the error rates, we will reduce the size of the dataset by combining all identical sequence reads into “unique sequences”. Then, using the dereplicated data and error rates, dada2 will infer the amplicon sequence variants (ASVs) in our data. These are essentially OTUs at 100% similarity. For the ONT pipeline, sequences are not merged because there are no paired end reads.
# File parsing
filtFs <- list.files(filtpathF, pattern="fastq.gz", full.names = TRUE)
# Sample names in order
sample.names <- gsub(".fastq.gz", "", basename(filtFs))
names(filtFs) <- sample.namesset.seed(100) # set seed to ensure that randomized steps are repeatable
# Learn forward error rates (Notes: randomize default is FALSE)
errF <- learnErrors(filtFs, nbases = 1e8, multithread = TRUE, randomize = TRUE)
## 95737061 total bases in 378485 reads from 8 samples will be used for learning the error rates.We want to make sure that the machine learning algorithm is learning the
error rates properly. In the plots below, the red line represents what
we should expect the learned error rates to look like for each of the 16
possible base transitions (A->A, A->C, A->G, etc.) and the black line
and grey dots represent what the observed error rates are. If the black
line and the red lines are very far off from each other, it may be a
good idea to increase the nbases parameter. This allows the machine
learning algorithm to train on a larger portion of your data and may
help improve the fit.
errF_plot <- plotErrors(errF, nominalQ = TRUE)
errF_plot# write error objects and plots to disk
saveRDS(errF, paste0(filtpathF, "/errF.rds"))
saveRDS(errF_plot, paste0(filtpathF, "/errF_plot.rds"))In this part of the pipeline, dada2 will make decisions about assigning
sequences to ASVs (called “sequence inference”). There is a major
parameter option in the core function dada() that changes how samples
are handled during sequence inference. The parameter pool = can be set
to: pool = FALSE (default), pool = TRUE, or pool = psuedo. For
details on parameter choice, please see below, and further information
on this blogpost
https://www.fiererlab.org/blog/archive-whats-in-a-number-estimating-microbial-richness-using-dada2,
and explanation on the dada2 tutorial
https://benjjneb.github.io/dada2/pool.html.
Details
pool = FALSE: Sequence information is not shared between samples. Fast
processing time, less sensitivity to rare taxa.
pool = psuedo: Sequence information is shared in a separate “prior”
step. Intermediate processing time, intermediate sensitivity to rare
taxa.
pool = TRUE: Sequence information from all samples is pooled together.
Slow processing time, most sensitivity to rare taxa.
For ONT data, another consideration is to set HOMOPOLYMER_GAP_PENALTY = -1. This is not necessary with V4 16S amplicons but may need to be implemented for others. Here is the information from the help page. HOMOPOLYMER_GAP_PENALTY: The cost of gaps in homopolymer regions (>=3 repeated bases). Default is NULL, which causes homopolymer gaps to be treated as normal gaps.
For simple communities or when you do not need high sensitivity for rare taxa
# make lists to hold the loop output
ddF <- vector("list", length(sample.names))
names(ddF) <- sample.names
# For each sample, get a list of merged and denoised sequences
for(sam in sample.names) {
cat("Processing:", sam, "\n")
# Dereplicate forward reads
derepF <- derepFastq(filtFs[[sam]])
# Infer sequences for forward reads
dadaF <- dada(derepF, err = errF, multithread = TRUE)
ddF[[sam]] <- dadaF
}
## Processing: BC001
## Sample 1 - 57088 reads in 11201 unique sequences.
## Processing: BC002
## Sample 1 - 40790 reads in 8613 unique sequences.
## Processing: BC003
## Sample 1 - 52281 reads in 11541 unique sequences.
## Processing: BC004
## Sample 1 - 68950 reads in 13209 unique sequences.
## Processing: BC005
## Sample 1 - 55301 reads in 11880 unique sequences.
## Processing: BC006
## Sample 1 - 55111 reads in 11295 unique sequences.
## Processing: BC007
## Sample 1 - 48896 reads in 10196 unique sequences.
## Processing: BC008
## Sample 1 - 68 reads in 37 unique sequences.
rm(derepF)For complex communities when you want to preserve rare taxa. Note: This
adds substantially more computational time!! Learn more about pooling
here: https://benjjneb.github.io/dada2/pool.html. The DADA2 author
Benjamin Callahan states there that: “The large majority of ASVs, and
the vast majority of reads (>99%) are commonly assigned between these
methods. Either method provides an accurate reconstruction of your
sampled communities.” alternative: swap pool = TRUE with
pool = "pseudo"
# same steps, but not in loop because samples are now pooled
# Dereplicate forward reads
derepF.p <- derepFastq(filtFs)
names(derepF.p) <- sample.names
# Infer sequences for forward reads
dadaF.p <- dada(derepF.p, err = errF, multithread = TRUE, pool = TRUE)
names(dadaF.p) <- sample.names
# Rename to the same as unpooled to proceed with seqtab step
ddF <- dadaF.pseqtab <- makeSequenceTable(ddF)
# Save table as an r data object file
dir.create(table.fp)
saveRDS(seqtab, paste0(table.fp, "/seqtab.rds"))If you have multiple sequencing runs, if you have processed them each to this point, you can now load all of your different seqtab.rds files in here and merge them. Then you can remove chimeras and assign taxonomy just on the one merged table.
# seqtab1 <- readRDS(paste0(table.fp, "/seqtab.rds"))
# seqtab2 <- readRDS("path/to/other/seqtab.rds")
# seqtab <- mergeSequenceTables(seqtab1, seqtab2)Although dada2 has searched for indel errors and substitutions, there may still be chimeric sequences in our dataset (sequences that are derived from forward and reverse sequences from two different organisms becoming fused together during PCR and/or sequencing). To identify chimeras, we will search for rare sequence variants that can be reconstructed by combining left-hand and right-hand segments from two more abundant “parent” sequences. After removing chimeras, we will use a taxonomy database to train a naive Bayesian classifier-algorithm to assign names to our sequence variants.
For this 16S tutorial, we will assign taxonomy with SILVA db v138.1, but you might want to use other databases for your data. We also include a second step to add species assignment based on exact matching. Be wary of species assignments with short amplicons. It’s always a good idea to BLAST your top ASVs of interest to confirm the taxonomy. Other options for 16S include Greengenes, GTDB, and RDP. Below are paths to some of the databases we use often. If you want to use SILVA for 18S instead of PR2, make sure you use the one that is suitable for 18S, which is different than the 16S one and is from release 132. Databases are periodically updated so make sure you check for new releases and use the latest versions. (If you are on your own computer you can download the database you need from this link https://benjjneb.github.io/dada2/training.html:)
-
16S bacteria and archaea (SILVA db): /db_files/dada2/silva_nr99_v138.1_train_set.fa
-
ITS fungi (UNITE db): /db_files/dada2/sh_general_release_dynamic_19.02.2025.fasta
-
18S protists (PR2 db): /db_files/dada2/pr2_version_5.0.0_SSU_dada2.fasta.gz
-
trnL plants (from Jonah): /db_files/dada2/trnL_taxDB_20250217_dada2.fasta
- CO1 arthropods (from Jonah): /db_files/dada2/BOLD_Public_COI_reformat_20250328_CB.fasta.gz --Recommend using custom BLAST for CO1 though.
# Read in RDS
st.all <- readRDS(paste0(table.fp, "/seqtab.rds"))
# Remove chimeras
seqtab.nochim <- removeBimeraDenovo(st.all,
method = "consensus",
multithread = TRUE)
# Print percentage of our sequences that were not chimeric.
100*sum(seqtab.nochim)/sum(seqtab)
## [1] 83.69265
# Print starting number of ASVs, number of chimeras, and non-chimeric ASVs
ncol(st.all) # starting number of ASVs
## [1] 295
ncol(st.all) - ncol(seqtab.nochim) # number of chimeras. there are removed.
## [1] 281
ncol(seqtab.nochim) # number of non-chimeric ASVs
## [1] 14Note: assignTaxonomy implements the RDP Naive Bayesian Classifier algorithm described in Wang et al. Applied and Environmental Microbiology 2007, with kmer size 8 and 100 bootstrap replicates. For 16S we use two steps to do species-level assignment. For ITS/trnL, use the below sections, which does it all at once, but take the species IDs with a grain of salt.
tax <- assignTaxonomy(seqs = seqtab.nochim,
refFasta = "/db_files/dada2/silva_nr99_v138.1_train_set.fa",
minBoot = 50,
tryRC = TRUE,
outputBootstraps = FALSE,
taxLevels = c("Kingdom", "Phylum", "Class", "Order", "Family", "Genus"),
multithread = TRUE,
verbose = FALSE)
# If you want to add species level, you must use this separate function that uses exact matching
# This uses a separate SILVA database with the species information
tax <- addSpecies(taxtab = tax,
refFasta = "/db_files/dada2/silva_species_assignment_v138.1.fa.gz",
allowMultiple = FALSE,
tryRC = TRUE,
n = 1e5,
verbose = FALSE)
# Write results to disk
saveRDS(seqtab.nochim, paste0(table.fp, "/seqtab_final.rds"))
saveRDS(tax, paste0(table.fp, "/tax_final.rds"))tax <- assignTaxonomy(seqs = seqtab.nochim,
refFasta = "/db_files/dada2/sh_general_release_dynamic_19.02.2025.fasta",
minBoot = 50,
tryRC = TRUE,
outputBootstraps = FALSE,
multithread = TRUE,
verbose = FALSE)
saveRDS(seqtab.nochim, paste0(table.fp, "/seqtab_final.rds"))
saveRDS(tax, paste0(table.fp, "/tax_final.rds"))tax <- assignTaxonomy(seqs = seqtab.nochim,
refFasta = "/db_files/dada2/trnL_taxDB_20250217_dada2.fasta",
minBoot = 50,
tryRC = TRUE,
outputBootstraps = FALSE,
multithread = TRUE,
verbose = FALSE)
saveRDS(seqtab.nochim, paste0(table.fp, "/seqtab_final.rds"))
saveRDS(tax, paste0(table.fp, "/tax_final.rds"))# Note: This has yielded a lot of NA assignments, so probably best to use Jonah's custom BLAST method instead
tax <- assignTaxonomy(seqs = seqtab.nochim,
refFasta = "/db_files/dada2/BOLD_Public_COI_reformat_20250328_CB.fasta.gz",
minBoot = 50,
tryRC = TRUE,
outputBootstraps = FALSE,
multithread = TRUE,
verbose = FALSE)
saveRDS(seqtab.nochim, paste0(table.fp, "/seqtab_final.rds"))
saveRDS(tax, paste0(table.fp, "/tax_final.rds"))
For convenience, we will now rename our ASVs with numbers, output our results as a traditional taxa table, and create a matrix with the representative sequences for each ASV. Having the actual sequences for each ASV is important if you want to build a phylogenetic tree or do additional taxonomic investigation.
# Flip table
seqtab.t <- as.data.frame(t(seqtab.nochim))
# Pull out ASV repset
rep_set_ASVs <- as.data.frame(rownames(seqtab.t))
rep_set_ASVs <- mutate(rep_set_ASVs, ASV_ID = 1:n())
rep_set_ASVs$ASV_ID <- sub("^", "ASV_", rep_set_ASVs$ASV_ID)
rep_set_ASVs$ASV <- rep_set_ASVs$`rownames(seqtab.t)`
rep_set_ASVs$`rownames(seqtab.t)` <- NULL
# Add ASV numbers to table
rownames(seqtab.t) <- rep_set_ASVs$ASV_ID
# Add ASV numbers to taxonomy
taxonomy <- as.data.frame(tax)
taxonomy$ASV <- as.factor(rownames(taxonomy))
taxonomy <- merge(rep_set_ASVs, taxonomy, by = "ASV")
rownames(taxonomy) <- taxonomy$ASV_ID
# Note: If you used a database that only goes to genus level, delete the "Species" level here.
# Note: In mctoolsr, these will correspond to taxonomy1-8 (or 1-7 for genus level)
taxonomy_for_mctoolsr <- unite(taxonomy,
"taxonomy",
c("Kingdom", "Phylum", "Class", "Order",
"Family", "Genus", "Species", "ASV_ID"),
sep = ";")
# Write repset to fasta file
# create a function that writes fasta sequences
writeRepSetFasta<-function(data, filename){
fastaLines = c()
for (rowNum in 1:nrow(data)){
fastaLines = c(fastaLines, as.character(paste(">", data[rowNum,"name"], sep = "")))
fastaLines = c(fastaLines,as.character(data[rowNum,"seq"]))
}
fileConn<-file(filename)
writeLines(fastaLines, fileConn)
close(fileConn)
}
# Arrange the taxonomy dataframe for the writeRepSetFasta function
# Note: Remove Species according to your database.
taxonomy_for_fasta <- taxonomy %>%
unite("TaxString",
c("Kingdom", "Phylum", "Class", "Order",
"Family", "Genus", "Species", "ASV_ID"),
sep = ";",
remove = FALSE) %>%
unite("name",
c("ASV_ID", "TaxString"),
sep = " ",
remove = TRUE) %>%
select(ASV, name) %>%
rename(seq = ASV)
# write fasta file
writeRepSetFasta(taxonomy_for_fasta, paste0(table.fp, "/repset.fasta"))
# Merge taxonomy and table
seqtab_wTax <- merge(seqtab.t, taxonomy_for_mctoolsr, by = 0)
seqtab_wTax$ASV <- NULL
# Set name of table in mctoolsr format and save
out_fp <- paste0(table.fp, "/seqtab_wTax_mctoolsr.txt")
names(seqtab_wTax)[1] = "#ASV_ID"
write("#Exported for mctoolsr", out_fp)
suppressWarnings(write.table(seqtab_wTax, out_fp, sep = "\t", row.names = FALSE, append = TRUE))
# Also export files as .txt
write.table(seqtab.t, file = paste0(table.fp, "/seqtab_final.txt"),
sep = "\t", row.names = TRUE, col.names = NA)
write.table(tax, file = paste0(table.fp, "/tax_final.txt"),
sep = "\t", row.names = TRUE, col.names = NA)
# Optional: Output for phyloseq, if you use phyloseq instead of mctoolsr
# library(BiocManager)
# BiocManager::install("phyloseq")
# library(phyloseq)
# Use seqtab.nochim for the otu_table
# Use the tax object from assignTaxonomy() for the tax_table
# Load in your sample metadata and call it samdf. Sample IDs much match the row names of seqtab.nochim
# ps <- phyloseq(otu_table(seqtab.nochim, taxa_are_rows = FALSE),
# sample_data(samdf),
# tax_table(tax))- seqtab_final.txt - A tab-delimited sequence-by-sample (i.e. OTU) table
- tax_final.txt - a tab-delimited file showing the relationship between ASVs, ASV IDs, and their taxonomy
- seqtab_wTax_mctoolsr.txt - a tab-delimited file with ASVs as rows, samples as columns and the final column showing the taxonomy of the ASV ID
- repset.fasta - a fasta file with the representative sequence of each ASV. Fasta headers are the ASV ID and taxonomy string.
Here we track the reads throughout the pipeline to see if any step is resulting in a greater-than-expected loss of reads. If a step is showing a greater than expected loss of reads, it is a good idea to go back to that step and troubleshoot why reads are dropping out. The dada2 tutorial has more details about what can be changed at each step.
getN <- function(x) sum(getUniques(x)) # function to grab sequence counts from output objects
# demultiplexed counts
dmFs <- sort(list.files(demux.fp, pattern=".fastq.gz", full.names = TRUE))
fq <- list()
for (i in 1:length(list.files(demux.fp))) {
fq[[i]] <- readFastq(dmFs[i])
}
demux_track <- as.data.frame(matrix(data = NA, nrow = length(list.files(demux.fp)), ncol = 2)) %>%
set_names(c("Sample", "demux"))
for (i in 1:length(list.files(demux.fp))) {
demux_track$Sample[i] <- gsub(".fastq.gz", "", basename(dmFs)[i])
demux_track$demux[i] <- length(fq[[i]])
}
# chopper reads
chFs <- sort(list.files(chopper.fp, pattern=".fastq.gz", full.names = TRUE))
fq <- list()
for (i in 1:length(list.files(chopper.fp))) {
fq[[i]] <- readFastq(chFs[i])
}
chopper_track <- as.data.frame(matrix(data = NA, nrow = length(list.files(chopper.fp)), ncol = 2)) %>%
set_names(c("Sample", "chopper"))
for (i in 1:length(list.files(chopper.fp))) {
chopper_track$Sample[i] <- gsub(".fastq.gz", "", basename(chFs)[i])
chopper_track$chopper[i] <- length(fq[[i]])
}
# filtN reads
nnFs <- sort(list.files(filtN.fp, pattern=".fastq.gz", full.names = TRUE))
fq <- list()
for (i in 1:length(list.files(filtN.fp))) {
fq[[i]] <- readFastq(nnFs[i])
}
filtN_track <- as.data.frame(matrix(data = NA, nrow = length(list.files(filtN.fp)), ncol = 2)) %>%
set_names(c("Sample", "filtN"))
for (i in 1:length(list.files(filtN.fp))) {
filtN_track$Sample[i] <- gsub(".fastq.gz", "", basename(nnFs)[i])
filtN_track$filtN[i] <- length(fq[[i]])
}
# Now back to the old pipeline
# Here reads.in and reads.out are cutadapt counts and final filter/trim counts
filt_out_track <- filt_out %>%
data.frame() %>%
mutate(Sample = gsub(".fastq.gz", "",rownames(.))) %>%
rename(cutadapt = reads.in, filtered = reads.out) %>%
remove_rownames() %>%
column_to_rownames(var = "Sample") %>%
mutate(Sample = rownames(.))
# If you did not pool samples, use this
ddF_track <- data.frame(denoised = sapply(ddF[sample.names], getN)) %>%
mutate(Sample = row.names(.))
# If you used samples = pooled, use this
# ddF_track <- data.frame(denoisedF = sapply(derepF.p[sample.names], getN)) %>% mutate(Sample = row.names(.))
chim_track <- data.frame(nonchim = rowSums(seqtab.nochim)) %>%
mutate(Sample = row.names(.))
track <- left_join(demux_track, chopper_track, by = "Sample") %>%
left_join(filtN_track, by = "Sample") %>%
left_join(filt_out_track, by = "Sample") %>%
left_join(ddF_track, by = "Sample") %>%
left_join(chim_track, by = "Sample") %>%
replace(., is.na(.), 0) %>%
column_to_rownames(var = "Sample") %>%
mutate(Sample = rownames(.)) %>%
select(Sample, everything())
track
## Sample demux chopper filtN cutadapt filtered denoised nonchim
## BC001 BC001 230210 57695 57695 57695 57088 56828 48017
## BC002 BC002 159967 41224 41224 41224 40790 40499 35004
## BC003 BC003 205373 52782 52782 52782 52281 52046 42590
## BC004 BC004 264178 69690 69690 69690 68950 68700 58160
## BC005 BC005 211654 55908 55908 55908 55301 55107 45089
## BC006 BC006 213836 55707 55707 55707 55111 54928 45533
## BC007 BC007 184467 49457 49457 49457 48896 48657 40921
## BC008 BC008 1079 69 69 69 68 65 65
# tracking reads by percentage
track_pct <- track %>%
mutate(chopper_pct = ifelse(filtered == 0, 0, 100 * (chopper/demux)),
filtN_pct = ifelse(filtered == 0, 0, 100 * (filtN/chopper)),
cutadapt_pct = ifelse(filtered == 0, 0, 100 * (cutadapt/filtN)),
filtered_pct = ifelse(filtered == 0, 0, 100 * (filtered/cutadapt)),
denoisedF_pct = ifelse(denoised == 0, 0, 100 * (denoised/filtered)),
nonchim_pct = ifelse(nonchim == 0, 0, 100 * (nonchim/denoised)),
total_pct = ifelse(nonchim == 0, 0, 100 * nonchim/demux)) %>%
select(Sample, ends_with("_pct"))
# summary stats of tracked reads averaged across samples
track_pct_avg <- track_pct %>% summarize_at(vars(ends_with("_pct")),
list(avg = mean))
track_pct_med <- track_pct %>% summarize_at(vars(ends_with("_pct")),
list(med = stats::median))
track_pct_avg
## chopper_pct_avg filtN_pct_avg cutadapt_pct_avg filtered_pct_avg
## 1 23.57305 100 100 98.89311
## denoisedF_pct_avg nonchim_pct_avg total_pct_avg
## 1 99.05446 85.77925 19.53716
track_pct_med
## chopper_pct_med filtN_pct_med cutadapt_pct_med filtered_pct_med
## 1 25.91079 100 100 98.93414
## denoisedF_pct_med nonchim_pct_med total_pct_med
## 1 99.54753 84.29814 21.29829
# Plotting each sample's reads through the pipeline
track_plot <- track %>%
gather(key = "Step", value = "Reads", -Sample) %>%
mutate(Step = factor(Step,
levels = c("demux", "chopper", "filtN", "cutadapt",
"filtered", "denoised", "nonchim"))) %>%
ggplot(aes(x = Step, y = Reads)) +
geom_line(aes(group = Sample), alpha = 0.2) +
geom_point(alpha = 0.5, position = position_jitter(width = 0)) +
stat_summary(fun = median, geom = "line", group = 1, color = "steelblue", linewidth = 1, alpha = 0.5) +
stat_summary(fun = median, geom = "point", group = 1, color = "steelblue", size = 2, alpha = 0.5) +
stat_summary(fun.data = median_hilow, fun.args = list(conf.int = 0.5),
geom = "ribbon", group = 1, fill = "steelblue", alpha = 0.2) +
geom_label(data = t(track_pct_avg[1:6]) %>% data.frame() %>%
rename(Percent = 1) %>%
mutate(Step = c("chopper", "filtN", "cutadapt",
"filtered", "denoised", "nonchim"),
Percent = paste(round(Percent, 2), "%")),
aes(label = Percent), y = 1.1 * max(track[,2])) +
geom_label(data = track_pct_avg[7] %>% data.frame() %>%
rename(total = 1),
aes(label = paste("Total\nRemaining:\n", round(track_pct_avg[1,7], 2), "%")),
y = mean(track[,8]), x = 8) +
expand_limits(y = 1.1 * max(track[,2]), x = 9) +
theme_classic()
track_plot# Write results to disk
ggsave(plot = track_plot, filename = paste0(project.fp, "/tracking_reads_summary_plot.png"),
width = 8, height = 6, dpi = "retina")
saveRDS(track, paste0(project.fp, "/tracking_reads.rds"))
saveRDS(track_pct, paste0(project.fp, "/tracking_reads_percentage.rds"))
saveRDS(track_plot, paste0(project.fp, "/tracking_reads_summary_plot.rds"))You can now transfer over the output files onto your local computer. The table and taxonomy can be read into R with ‘mctoolsr’ package or another R package of your choosing.
After following this pipeline, you will need to think about the following in downstream applications:
- Remove ASVs assigned as mitochondrial or chloroplast
- Remove ASVs assigned as eukaryotes
- Remove ASVs that are unassigned at the domain level
- Remove ASVs that only have 1 or 2 sequences in the entire dataset
- Normalize or rarefy your ASV table
For more information on these steps, see https://github.com/cliffbueno/Alpha-Beta-Tutorial



